spoVE [2019-07-01 09:58:10]

SEDS family peptidoglycan glycosyltransferase, required for spore cortex peptidoglycan synthesis

Locus: BSU15210

Isoelectric point: 9.85

Molecular weight: 39.97 kDa

Protein length: 366 aa

Gene length: 1101 bp

Function: spore cortex peptidoglycan synthesis

Product: SEDS family peptidoglycan glycosyltransferase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of peptidoglycan
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of peptidoglycan
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,590,317 1,591,417

The protein

Protein family

• FtsW/RodA/SpoVE family (according to Swiss-Prot)
• SEDS proteins (shape, elongation, division, and sporulation) PubMed

Paralogous protein(s)

• FtsW, RodA

Structure

• 6BAR (from Thermus thermophilus,corresponds to aa 99... 357, 38% identity) PubMed

Localization

• integral membrane protein, forespore PubMed

Expression and Regulation

Operons

• Genes: murE-mraY-murD-spoVE-murG-murB-divIB-ylxW-ylxX-sbp
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • SpoIIID: repression, PubMed, in SpoIIID regulon

  Regulation

  • expressed during vegatative growth PubMed

• Genes: spoVE
  Description: PubMed

  Regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell (SigE) PubMed

• Genes: spoVE-murG-murB-divIB-ylxW-ylxX-sbp
  Description: PubMed

  Regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell (SigE) PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• BKE15210 (spoVE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAGCAATCGACACCCCAA, downstream forward: _UP4_TAACGAATGTATTTCCAAGC
• BKK15210 (spoVE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAGCAATCGACACCCCAA, downstream forward: _UP4_TAACGAATGTATTTCCAAGC

References

Loading